CLONING OF THE RICE (Oryza sativa) GLUTELIN-B-1 PROMOTER, TOWARDS THE DEVELOPMENT OF A RICE ENDOSPERM SPECIFIC EXPRESSION VECTOR

Abstract

Rice flour does not have dough making properties and hence vast amount of foreign exchange is spent on importation of wheat for production of bread and other bakery products. Wheat flour has its unique dough property. This property is required for making bread and other related food products. Development of wheat-like rice would be beneficial as a substitute for wheat flour. Glutelin genes are selectively expressed in the rice endosperm. Thus, the glutelin promoter is an ideal candidate to drive seed specific expression of trans-genes in rice. The objective of this study was to clone the minimal glutelin B1 (Glu Bl) promoter from a variety of Oryza sativa sub species indica. The Glu B1 promoter of the rice variety Bg300 were initially amplified by the polymerase chain reaction (PCR) using a set of primers (FIS'CTCAAGC ATAAGACGTTTATG3 'R1 -5 'CGCCATAGCTATTTGTACTTC3') flanking the promoter region and followed by nested PCR (F2- 5 'GGGG AATTC AC AT ATT AAG AGT AT GG AC AG AC 3', R2- 5'GGGGGATCCTTAAGCTAATGATGGGTTC3') to amplify the minimal promoter of 262 bp. The PCR primers were designed based on the published Glu Bl promoter sequence of the Oryza sativa japonica sub species. Single PCR-amplified products of the expected size were obtained for Oryza sativa, indica rice variety. Subsequently these fragments were cloned into pUC19 vector. Positive transformants were analyzed by colony PCR and Pvu 11 restriction digestion, which confirmed the presence of the Glu Bl promoter region. The PCR amplified fragment of Bg 300 was sequenced and a BLAST search was performed against the available sequences in the NCBI data base. This revealed approximately 81% sequence similarity to Glu Bl promoter sequence derived from Oryza sativa , japonica sub species. Further analysis of the obtained sequence revealed the presence of AACA, GCN4, PROL and ACGT motifs, which are conserved in many seed storage protein genes and are crucial for seed specific expression. These results indicate that the amplified sequence corresponds to the authentic Glu Bl promoter region from Oryza sativa subspecies indica. This cloned Glu Bl promoter will be used in a subsequent study to develop an expression vector to drive endosperm specific expression of wheat glutenin and gliadin trans genes in rice.