Abstract:
Unfermented coconut sap is one of the natural drinks, being traditionally tapped from unopened
inflorescence of coconut palm. Unfermented coconut sap undergoes rapid fermentation after
contacting with the microorganisms present in the atmosphere; hence the quality of the sap is
deteriorated. In the present study, two different sap collection systems were evaluated, namely
traditional clay pot system and a poly-bag collection method treated with Vateria copallifera.
The microbial quality of collected sap was evaluated through molecular methods. DNA was
extracted by the modified Cetyl Trimethyl Ammonium Bromide (CTAB) method from the
microbial colonies isolated from the collected coconut sap by the two collection systems. ITS1
forward (5' TCCG TAG GTGAACCTGCGG 3') and ITS4 (5' TCCTCCGCTTATTGATATGC 3') reverse
primers were used for yeast species and 27 forward (5'-AGAGTTTGATCCTGGCTCAG-3') and
1492 reverse (5'-CGGTTACC TTGTTACGACTT-3') primers were used for the bacterial species for
Polymerase Chain Reaction (PCR) amplification. PCR products were analyzed using 1.5 %
agarose gel and amplified specific bands were purified with wizard PCR clean-up system.
Purified PCR products were subjected to DNA sequencing. Three types (A, B, C) of distinct
microbial colonies were isolated from the sap samples collected by two methods. DNA
homology data analysis by BLAST concluded that, A, B and C isolates are Serratia marcescens,
Achromobacter xylosoxidans and Saccharomyces cerevisiae respectively. Saccharomyces
cerevisiae is the responsive microorganism for fermentation. Serratia marcescens and
Achromobacter xylosoxidans are environmental abounded opportunistic pathogen and it
restricts the direct consumption of unfermented coconut sap. Therefore, hygienic practices need
to be applied to increase the quality of coconut sap.
