Abstract:
Rice growth and productivity are seriously limited by several abiotic stresses; temperature, UV B radiation, drought, salinity and oxidative stress. It has been reported that Arabidopsis B-box
proteins (BBX) play a key role in light and abscisic acid insensitive abiotic stress regulation
pathway indicating that BBX protein could be an ideal candidate to develop multi-stress tolerant
crops. However, only a few rice BBX genes have been functionally characterized. In-silico
designing and simulating cloning protocols in genetic engineering can enhance the accuracy of
procedures. The main aims of this study were to identify the abiotic stress regulatory cis-acting
element on OsBBX6 promoter and simulate in-silico cloning of OsBBX6 coding sequence (CDS).
Oryza sativa indica upstream sequence (1.0 kb) of OsBBX6 (GenBank: CM000129.1) was
retrieved from the NCBI database. PlantCARE and New PLACE tools were used for screening of
cis-acting elements. Abiotic stress responsive elements namely salinity stress (GT1GMSCAM4,
MYBCORE), dehydration (MYB2CONSENSUSAT, CBFHV, MYBCORE), light (G-Box, GT1-motif, I box, Sp1, Box 4) and hormone (ABRE, DPBFCOREDCDC3, CGTCA-motif, TGACG-motif) were
identified on the OsBBX6 promoter region. Occurrence of cis-elements related to dehydration
and salinity stress, dehydration and abscisic acid in OsBBX6 promoter are two to five. Other
abiotic stress responsive elements occur once in the OsBBX6 promoter. PCR simulated by
SnapGene using forward primer (5’CCCATGGCGATGAAGGTGCAGTGCGACGTG3’) and reverse
primer (5’CGGTAACCTCACCAGTAGGAGTAGGAAGAAG3’) amplified the 830 bp OsBBX6 CDS.
Restriction cloning of CDS into pCAMBIA1303 at NcoI-BstEII restriction sites were carried out by
using SnapGene. This simulation showed that the OsBBX6 CDS in the recombinant plasmid
(pCAMBIA1303-OsBBX6) is in frame and therefore, 35S promoter can successfully over-express
OsBBX6 CDS after Agrobacterium mediated transformation into rice. Furthermore, this
simulation shows that NcoI and BstEII cleavage sites are not blocked by Dam methylase and Dcm
methyltransferases after cloning. Therefore, E. coli DH5α can be used for transformation of the
pCAMBIA1303-OsBBX6 recombinant plasmid. Taking together, in-silico analysis revealed that
OsBBX6 have a putative role in drought and salinity stress regulation and could be a possible
candidate to develop multi-stress tolerant rice.
