| dc.contributor.author | Cooray, R. | |
| dc.contributor.author | Madubashetha, H. | |
| dc.contributor.author | Wicramasinghe, S. | |
| dc.contributor.author | De Silva, N. | |
| dc.contributor.author | Warnakula, L. | |
| dc.date.accessioned | 2022-09-16T06:34:23Z | |
| dc.date.available | 2022-09-16T06:34:23Z | |
| dc.date.issued | 2019-12-05 | |
| dc.identifier.citation | Cooray, R. , Madubashetha, H. , Wicramasinghe, S. , De Silva, N. , & Warnakula, L. (2019). Optimization of a Protocol for the Extraction of DNA from Human Blood and Isolation of the Human Gene CtsK Using Polymerase Chain Reaction (PCR) Amplification Techniques. 2nd Research Symposium of the Faculty of Allied Health Sciences, University of Ruhuna, Galle, Sri Lanka, 58. | en_US |
| dc.identifier.issn | 2659-2029 | |
| dc.identifier.uri | http://ir.lib.ruh.ac.lk/xmlui/handle/iruor/8424 | |
| dc.description.abstract | Background: Cathepsin K, encoded by CtsK gene involves in bone remodeling through ossification. Besides this orthopaedic importance, it demonstrates other physiological importances including metastasis of prostate, ovarian, breast cancers and human growth regulation. Therefore, it is a timely concern that further molecular characterization be done on CtsK gene to facilitate further biomedical research and other aspects such as recombinant production of Cathespin K. Objectives: To develop an optimized protocol for isolation of DNA from human blood and PCR amplification of a catalytic domain of CtsK gene. Methodology: Genomic DNA was extracted from four human blood samples using FlexiGene®-QIAGen®, by subjecting blood to action of cell lysis, denaturation and resuspension buffers. Incubation time and number of 70% ethanol washings, volumes of isopropanol added were increased and absorbance of eluted DNA was measured spectrophotometricaly. PCR amplification of a catalytic domain of CtsK gene using forward primer 5‟ACGCGTCGACGTGTACCATCAGTACCTCGCAC3‟ and reverse primer 5‟ACGCAAGCTTCTTCCAAAGTGCATCGTTACAC3‟ was done. PCR conditions were optimized as; 94 ºC initial denaturation, 94 ºC denaturation, 55 ºC annealing, 72 ºC elongation, 72 ºC final elongation and 4 ºC final hold for 3 minutes, 30 seconds, 30 seconds, 40 seconds, 5 minutes and infinite, respectively. Results: Extracted DNA showed a concentration of nearly 500 ng/µL which increased drastically upon addition of more isopropanol to better pellet out DNA. İn terms of purity, A260/A280 ratio for DNA revealed to be between 1.7 and 1.8 while A260/A230 revealed to be between 1.7 and 2.2, reflecting optimum purity. As a result of optimization of PCR conditions, expected band size, as a clearband of size 265bp (between 200bp-300bp) was generated in 1.5% TAE-agarose gel, which was verified to be a catalytic domain of Cathepsin K by previous literature. Conclusions: An optimized protocol for extraction of quality DNA with high concentration was developed successfully and a catalytic domain of CtsK gene was successfully amplified. | en_US |
| dc.description.sponsorship | Academic staff members of the Faculty of Allied Health Science, University of Ruhuna | en_US |
| dc.language.iso | en | en_US |
| dc.publisher | Faculty of Allied Health Sciences, University of Ruhuna, Galle, Sri Lanka | en_US |
| dc.subject | Cathepsin K | en_US |
| dc.subject | CtsK | en_US |
| dc.subject | DNA Extraction | en_US |
| dc.subject | Human | en_US |
| dc.subject | PCR | en_US |
| dc.title | Optimization of a Protocol for the Extraction of DNA from Human Blood and Isolation of the Human Gene CtsK Using Polymerase Chain Reaction (PCR) Amplification Techniques | en_US |
| dc.type | Presentation | en_US |