Abstract:
Rice flour does not have dough making properties and hence vast amount of foreign exchange is spent on
importation of wheat for production of bread and other bakery products. Wheat flour has its unique dough
property. This property is required for making bread and other related food products. Development of
wheat-like rice would be beneficial as a substitute for wheat flour. Glutelin genes are selectively
expressed in the rice endosperm. Thus, the glutelin promoter is an ideal candidate to drive seed specific
expression of trans-genes in rice. The objective of this study was to clone the minimal glutelin B1 (Glu
Bl) promoter from a variety of Oryza sativa sub species indica. The Glu B1 promoter of the rice variety
Bg300 were initially amplified by the polymerase chain reaction (PCR) using a set of primers (FIS'CTCAAGC
ATAAGACGTTTATG3 'R1 -5 'CGCCATAGCTATTTGTACTTC3') flanking the promoter
region and followed by nested PCR (F2- 5 'GGGG AATTC AC AT ATT AAG AGT AT GG AC AG AC 3', R2-
5'GGGGGATCCTTAAGCTAATGATGGGTTC3') to amplify the minimal promoter of 262 bp. The
PCR primers were designed based on the published Glu Bl promoter sequence of the Oryza sativa
japonica sub species. Single PCR-amplified products of the expected size were obtained for Oryza sativa,
indica rice variety. Subsequently these fragments were cloned into pUC19 vector. Positive transformants
were analyzed by colony PCR and Pvu 11 restriction digestion, which confirmed the presence of the Glu
Bl promoter region. The PCR amplified fragment of Bg 300 was sequenced and a BLAST search was
performed against the available sequences in the NCBI data base. This revealed approximately 81%
sequence similarity to Glu Bl promoter sequence derived from Oryza sativa , japonica sub species.
Further analysis of the obtained sequence revealed the presence of AACA, GCN4, PROL and ACGT
motifs, which are conserved in many seed storage protein genes and are crucial for seed specific
expression. These results indicate that the amplified sequence corresponds to the authentic Glu Bl
promoter region from Oryza sativa subspecies indica. This cloned Glu Bl promoter will be used in a
subsequent study to develop an expression vector to drive endosperm specific expression of wheat
glutenin and gliadin trans genes in rice.