Molecular Confirmation of Foc race 1 is Crucial for Screening of Silk Banana for Fusarium Wilt (Fusarium oxysporum f. sp. cubense)

Show simple item record

dc.contributor.author Shirani, D.A.
dc.contributor.author Rajapakse, R.G.A.S.
dc.contributor.author Disanayake, D.M.K.K.
dc.contributor.author Abeysinghe, P.D.
dc.date.accessioned 2022-08-10T06:38:04Z
dc.date.available 2022-08-10T06:38:04Z
dc.date.issued 2020-02-14
dc.identifier.issn 1800-4830
dc.identifier.uri http://ir.lib.ruh.ac.lk/xmlui/handle/iruor/7435
dc.description.abstract Panama disease or Fusarium wilt of banana caused by Fusarium oxysporum f. sp. cubense (Foc) is a wide spread disease in Sri Lanka. ‘Kolikuttu’ (AAB, silk banana) which fetches a high market price is highly susceptible for Foc. Banana improvement through conventional techniques is cumbersome due to its sterility and polyploidy nature. However, development of resistant or less susceptible varieties to Foc is indispensable for sustainable banana production. Therefore, the present study was aimed to develop Foc resistant or less susceptible ‘kolikuttu’ variety through in-vitro mutagenesis. Chemically (1% Ethyl methanesulfonate) treated shoot tips of kolikuttu variety ‘Agra’ were in-vitro multiplied for 3 subculture cycles and resulted buds and plantlets were screened for Foc under in-vitro and protected house conditions, respectively. During the period, 16 cultures were prepared using the vascular strands of infected pseudostems of kolikuttu banana collected from different locations. Variations in mycelial growth and morphology of the cultures were observed among the samples on Potato Dextrose Agar plates. Therefore, the pathogen was confirmed through PCR before employing in screening. Genomic DNA from fresh single conidia cultures was isolated from 16 samples using CTAB method. PCR was carried out with Foc race 1 specific primers (FP GTTGAGTCTCGATAAACAGCAAT, RP-GACGAGGGGAGATATGGTC) with positive control (DNA from pure culture of Foc) and confirmation was made by the presence of 354bp amplicon. The molecular detection discriminated only 11 isolates to be Foc. The remaining isolates may be non pathogenic forms of endophytic Fusarium present in the pseudostem of infected banana. The results suggested the necessity of molecular confirmation of Foc in screening of banana against Fusarium wilt. en_US
dc.language.iso en en_US
dc.publisher Faculty of Agriculture, University of Ruhuna, Sri Lanka en_US
dc.relation.ispartofseries ISAE;2020
dc.subject Fusarium wilt en_US
dc.subject Kolikuttu banana en_US
dc.subject Molecular confirmation en_US
dc.title Molecular Confirmation of Foc race 1 is Crucial for Screening of Silk Banana for Fusarium Wilt (Fusarium oxysporum f. sp. cubense) en_US
dc.type Article en_US


Files in this item

This item appears in the following Collection(s)

Show simple item record

Search DSpace


Advanced Search

Browse

My Account