Abstract:
Panama disease or Fusarium wilt of banana caused by Fusarium oxysporum f. sp. cubense (Foc) is
a wide spread disease in Sri Lanka. ‘Kolikuttu’ (AAB, silk banana) which fetches a high market
price is highly susceptible for Foc. Banana improvement through conventional techniques is
cumbersome due to its sterility and polyploidy nature. However, development of resistant or
less susceptible varieties to Foc is indispensable for sustainable banana production. Therefore,
the present study was aimed to develop Foc resistant or less susceptible ‘kolikuttu’ variety
through in-vitro mutagenesis. Chemically (1% Ethyl methanesulfonate) treated shoot tips of
kolikuttu variety ‘Agra’ were in-vitro multiplied for 3 subculture cycles and resulted buds and
plantlets were screened for Foc under in-vitro and protected house conditions, respectively.
During the period, 16 cultures were prepared using the vascular strands of infected
pseudostems of kolikuttu banana collected from different locations. Variations in mycelial
growth and morphology of the cultures were observed among the samples on Potato Dextrose
Agar plates. Therefore, the pathogen was confirmed through PCR before employing in screening.
Genomic DNA from fresh single conidia cultures was isolated from 16 samples using CTAB
method. PCR was carried out with Foc race 1 specific primers (FP GTTGAGTCTCGATAAACAGCAAT, RP-GACGAGGGGAGATATGGTC) with positive control (DNA
from pure culture of Foc) and confirmation was made by the presence of 354bp amplicon. The
molecular detection discriminated only 11 isolates to be Foc. The remaining isolates may be non pathogenic forms of endophytic Fusarium present in the pseudostem of infected banana. The
results suggested the necessity of molecular confirmation of Foc in screening of banana against
Fusarium wilt.
